pT7-stl
(Plasmid
#51721)
-
Purpose(Empty Backbone) conditional gene knockdowns in Trypanosoma brucei
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLEW100
-
Backbone manufacturerGeorge Cross lab, Rockefeller University
-
Modifications to backboneThe sequence of pLew100 between BsiWI and MluI restriction sites was replaced with two T7 transcription terminators and by inserting the sequence 5´-CTAATACGACTCACTATAGGGATCTCCCTA TCAGTGATAGAGATCCCTATCAGTGATAGAGA-3´, which contains the T7 promoter and two tandem tetracycline operators, in the form of two hybridized oligonucleotides into the KpnI and HindIII sites.
-
Vector typeconditional gene knockdown in T. brucei
- Promoter T7 (2X)
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer Zeo-R (ctgatgaacagggtcacgtc)
- 3′ sequencing primer Sp6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Vector contains two gene cassettes arranged head-to head. To the left, a T7 promoter (black arrow) drives the expression of the bleomycin resistance gene which is bounded by the actin A gene flanks providing splicing and polyadenylation signals (act 5' and act 3'). The downstream ribosomal sequence (rib. spacer)facilitates targeting of the construct into the transcriptionally silent spacer region of an locus.
To the right, a T7 promoter under the control of two tetracycline operators (2x Tet op.) drives the expression of a stem-loop RNA whose coding region can be introduced into pT7-stl analogously to the established stem-loop cloning strategy (Shi, et al, 2000). The stem-loop RNA coding region is followed by two T7 transcription terminators (T7 trm.) and an aldolase gene 3' flank (ald 3').
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-stl was a gift from Arthur Gunzl (Addgene plasmid # 51721 ; http://n2t.net/addgene:51721 ; RRID:Addgene_51721) -
For your References section:
Multifunctional class I transcription in Trypanosoma brucei depends on a novel protein complex. Brandenburg J, Schimanski B, Nogoceke E, Nguyen TN, Padovan JC, Chait BT, Cross GA, Gunzl A. EMBO J. 2007 Nov 28;26(23):4856-66. Epub 2007 Nov 1. 10.1038/sj.emboj.7601905 PubMed 17972917