This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pT7-stl
(Plasmid #51721)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51721 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLEW100
  • Backbone manufacturer
    George Cross lab, Rockefeller University
  • Modifications to backbone
    The sequence of pLew100 between BsiWI and MluI restriction sites was replaced with two T7 transcription terminators and by inserting the sequence 5´-CTAATACGACTCACTATAGGGATCTCCCTA TCAGTGATAGAGATCCCTATCAGTGATAGAGA-3´, which contains the T7 promoter and two tandem tetracycline operators, in the form of two hybridized oligonucleotides into the KpnI and HindIII sites.
  • Vector type
    conditional gene knockdown in T. brucei
  • Promoter T7 (2X)
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer Zeo-R (ctgatgaacagggtcacgtc)
  • 3′ sequencing primer Sp6
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Vector contains two gene cassettes arranged head-to head. To the left, a T7 promoter (black arrow) drives the expression of the bleomycin resistance gene which is bounded by the actin A gene flanks providing splicing and polyadenylation signals (act 5' and act 3'). The downstream ribosomal sequence (rib. spacer)facilitates targeting of the construct into the transcriptionally silent spacer region of an locus.
To the right, a T7 promoter under the control of two tetracycline operators (2x Tet op.) drives the expression of a stem-loop RNA whose coding region can be introduced into pT7-stl analogously to the established stem-loop cloning strategy (Shi, et al, 2000). The stem-loop RNA coding region is followed by two T7 transcription terminators (T7 trm.) and an aldolase gene 3' flank (ald 3').

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-stl was a gift from Arthur Gunzl (Addgene plasmid # 51721 ; http://n2t.net/addgene:51721 ; RRID:Addgene_51721)
  • For your References section:

    Multifunctional class I transcription in Trypanosoma brucei depends on a novel protein complex. Brandenburg J, Schimanski B, Nogoceke E, Nguyen TN, Padovan JC, Chait BT, Cross GA, Gunzl A. EMBO J. 2007 Nov 28;26(23):4856-66. Epub 2007 Nov 1. 10.1038/sj.emboj.7601905 PubMed 17972917