-
PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51765 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR (pXPR_001), Addgene plasmid #49535
-
Backbone manufacturerZhang lab
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9
-
Alt nameS. pyogenes CRISPR-Cas9
-
SpeciesSynthetic
-
Insert Size (bp)4200
- Promoter EFS
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GGTACAGTGCAGGGGAAAGA
- 3′ sequencing primer TGCCCTCCAAATATGTGAACT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePuromycin resistance
-
Alt namepuromycin N-acetyl-transferase
-
Alt namePAC
-
Insert Size (bp)600
- Promoter EFS
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer TGCTGCTACTAAGAAAGCTGGTC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameEGFP sgRNA 6
-
Alt nameEGFP targeting RNA element #6 (with +85 chimeric RNA)
-
SpeciesSynthetic
-
Insert Size (bp)96
- Promoter U6
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer #140 hU6-F (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence GGTGAACCGCATCGAGCTGA
These six EGFP-targeting lentiCRISPRs have EGFP-targeting sgRNAs cloned into the lentiCRISPR backbone plasmid (Addgene plasmid 49535) and are used in Fig 1B of Shalem*, Sanjana* et al (2014). If you want to clone your own targeting sequences, please use the lentiCRISPR backbone plasmid (Addgene plasmid 49535), as the sgRNA Type IIs cloning site is not present in these plasmids.
Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check https://zlab.bio/ for the most up-to-date information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR - EGFP sgRNA 6 was a gift from Feng Zhang (Addgene plasmid # 51765 ; http://n2t.net/addgene:51765 ; RRID:Addgene_51765) -
For your References section:
Genome-scale CRISPR-Cas9 knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. 10.1126/science.1247005 PubMed 24336571