Skip to main content

pHyVec12
(Plasmid #51851)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51851 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBlueScript II SK+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 7193
  • Vector type
    RNAi ; Hydra Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GFP hairpin
  • Promoter Actin

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer ATGAGTAAAGGAGAAGAACT
  • 3′ sequencing primer ATCAAAAATGAGGTAAAGGAGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    DsRed2
  • Promoter Actin

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer ATGGCCGATGATGAAGTTGC
  • 3′ sequencing primer CTATAAAAATAAATGATGTCTAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Robert Steele
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHyVec12 was a gift from Haifan Lin (Addgene plasmid # 51851 ; http://n2t.net/addgene:51851 ; RRID:Addgene_51851)
  • For your References section:

    PIWI proteins and PIWI-interacting RNAs function in Hydra somatic stem cells. Juliano CE, Reich A, Liu N, Gotzfried J, Zhong M, Uman S, Reenan RA, Wessel GM, Steele RE, Lin H. Proc Natl Acad Sci U S A. 2014 Jan 7;111(1):337-42. doi: 10.1073/pnas.1320965111. Epub 2013 Dec 23. 10.1073/pnas.1320965111 PubMed 24367095