pHyVec12
(Plasmid
#51851)
-
PurposeExpression in Hydra for RNAi
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBlueScript II SK+
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 7193
-
Vector typeRNAi ; Hydra Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGFP hairpin
- Promoter Actin
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer ATGAGTAAAGGAGAAGAACT
- 3′ sequencing primer ATCAAAAATGAGGTAAAGGAGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameDsRed2
- Promoter Actin
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ATGGCCGATGATGAAGTTGC
- 3′ sequencing primer CTATAAAAATAAATGATGTCTAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRobert Steele
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHyVec12 was a gift from Haifan Lin (Addgene plasmid # 51851 ; http://n2t.net/addgene:51851 ; RRID:Addgene_51851) -
For your References section:
PIWI proteins and PIWI-interacting RNAs function in Hydra somatic stem cells. Juliano CE, Reich A, Liu N, Gotzfried J, Zhong M, Uman S, Reenan RA, Wessel GM, Steele RE, Lin H. Proc Natl Acad Sci U S A. 2014 Jan 7;111(1):337-42. doi: 10.1073/pnas.1320965111. Epub 2013 Dec 23. 10.1073/pnas.1320965111 PubMed 24367095