Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCAH-MIBP16
(Plasmid #51870)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51870 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 12200
  • Modifications to backbone
    Digested with EcoRI, ligated with an adaptor containing a NotI site and then digested with NotI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MIBP1
  • Alt name
    HIVEP2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    7400
  • Entrez Gene
    Hivep2 (a.k.a. MIBP1)
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (destroyed during cloning)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTG
  • 3′ sequencing primer AGGGCATTGGCCACACCAGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAH-MIBP16 was a gift from Kenshi Hayashi & Tomoko Tahira (Addgene plasmid # 51870 ; http://n2t.net/addgene:51870 ; RRID:Addgene_51870)
  • For your References section:

    Genome-wide repression of NF-kappaB target genes by transcription factor MIBP1 and its modulation by O-linked beta-N-acetylglucosamine (O-GlcNAc) transferase. Iwashita Y, Fukuchi N, Waki M, Hayashi K, Tahira T. J Biol Chem. 2012 Mar 23;287(13):9887-900. doi: 10.1074/jbc.M111.298521. Epub 2012 Jan 31. 10.1074/jbc.M111.298521 PubMed 22294689