Skip to main content
Addgene

pCAE-MIBP1
(Plasmid #51873)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51873 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 12100
  • Modifications to backbone
    Digested with EcoRI, ligated with an adaptor containing a NotI site and then digested with NotI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MIBP1
  • Alt name
    HIVEP2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    7400
  • Entrez Gene
    Hivep2 (a.k.a. MIBP1)
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTG
  • 3′ sequencing primer AGGGCATTGGCCACACCAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Makino, R., Akiyama, K., Yasuda, J., Mashiyama, S., Honda, S., Sekiya, T., & Hayashi, K. (1994). Cloning and characterization of a c-myc intron binding protein (MIBP1). Nucleic acids research, 22(25), 5679-5685.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAE-MIBP1 was a gift from Kenshi Hayashi & Tomoko Tahira (Addgene plasmid # 51873 ; http://n2t.net/addgene:51873 ; RRID:Addgene_51873)
  • For your References section:

    Characterization of the biological functions of a transcription factor, c-myc intron binding protein 1 (MIBP1). Fukuda S, Yamasaki Y, Iwaki T, Kawasaki H, Akieda S, Fukuchi N, Tahira T, Hayashi K. J Biochem. 2002 Mar;131(3):349-57. 10.1093/oxfordjournals.jbchem.a003109 PubMed 11872163