Skip to main content

paavCAG-iCre
(Plasmid #51904)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51904 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    paavCAG
  • Backbone size w/o insert (bp) 5000
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    improved Cre recombinase
  • Alt name
    iCre
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1056
  • GenBank ID
    AY056050
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gcggctctagagcctctgcta
  • 3′ sequencing primer ttaaagcagcgtatccacat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    paavCAG-iCre was a gift from Jinhyun Kim (Addgene plasmid # 51904 ; http://n2t.net/addgene:51904 ; RRID:Addgene_51904)
  • For your References section:

    Structured Synaptic Connectivity between Hippocampal Regions. Druckmann S, Feng L, Lee B, Yook C, Zhao T, Magee JC, Kim J. Neuron. 2014 Feb 5;81(3):629-40. doi: 10.1016/j.neuron.2013.11.026. Epub 2014 Jan 9. 10.1016/j.neuron.2013.11.026 PubMed 24412418