Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MSCV-shCasp2-IRES-GFP
(Plasmid #52061)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52061 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV-IRES-GFP-Puro
  • Backbone manufacturer
    Addgene plasmid #20672
  • Backbone size w/o insert (bp) 5900
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Caspase-2 shRNA
  • Alt name
    caspase 2, apoptosis-related cysteine peptidase
  • gRNA/shRNA sequence
    TGCTGTTGACAGTGAGCGCCCCAACTTCCCTGTTCTTTAATAGTGAAGCCACAGAT GTATTAAAGAACAGGGAAGTTGGGATGCCTACTGCCTCGGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    CASP2 (a.k.a. CASP-2, ICH1, NEDD-2, NEDD2, PPP1R57)
  • Tag / Fusion Protein
    • IRES-EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer pLXSN5; pBABE5
  • 3′ sequencing primer pCDH-rev (GCATTCCTTTGGCGAGAG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-shCasp2-IRES-GFP was a gift from Tyler Jacks & Trudy Oliver (Addgene plasmid # 52061 ; http://n2t.net/addgene:52061 ; RRID:Addgene_52061)
  • For your References section:

    Caspase-2-mediated cleavage of Mdm2 creates a p53-induced positive feedback loop. Oliver TG, Meylan E, Chang GP, Xue W, Burke JR, Humpton TJ, Hubbard D, Bhutkar A, Jacks T. Mol Cell. 2011 Jul 8;43(1):57-71. doi: 10.1016/j.molcel.2011.06.012. 10.1016/j.molcel.2011.06.012 PubMed 21726810