pCAG-DN-RFX
(Plasmid
#52296)
-
PurposeDominant-negatively inhibits RFX (regulatory factor X) transcription factor. Made of mouse RFX1 DNA binding domain (400-527 aa) and C-terminal myc tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGEN
- Backbone size w/o insert (bp) 4798
- Total vector size (bp) 5239
-
Modifications to backboneAdditional restriction enzyme sites were added.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDominant negative RFX
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)423
- Promoter CAG promoter
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TGTGACCGGCGGCTCTAGAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mouse RFX1 DNA binding domain (400-527 aa) with a C-terminal Myc tag
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-DN-RFX was a gift from Christopher A Walsh (Addgene plasmid # 52296 ; http://n2t.net/addgene:52296 ; RRID:Addgene_52296) -
For your References section:
Evolutionarily dynamic alternative splicing of GPR56 regulates regional cerebral cortical patterning. Bae BI, Tietjen I, Atabay KD, Evrony GD, Johnson MB, Asare E, Wang PP, Murayama AY, Im K, Lisgo SN, Overman L, Sestan N, Chang BS, Barkovich AJ, Grant PE, Topcu M, Politsky J, Okano H, Piao X, Walsh CA. Science. 2014 Feb 14;343(6172):764-8. doi: 10.1126/science.1244392. 10.1126/science.1244392 PubMed 24531968