pEL392
(Plasmid
#52348)
-
PurposeGFP reporter for fli-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPD95.77
-
Backbone manufacturerFire lab
- Backbone size w/o insert (bp) 4487
- Total vector size (bp) 13418
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namefli-1
-
Alt nameFlightless
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)8931
-
Entrez Genefli-1 (a.k.a. CELE_B0523.5)
- Promoter fli-1
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer CAGGAAACAGCTATGACCATG
- 3′ sequencing primer CCTCTGACACATGCAGCTCCCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEL392 was a gift from Erik Lundquist (Addgene plasmid # 52348 ; http://n2t.net/addgene:52348 ; RRID:Addgene_52348) -
For your References section:
FLI-1 Flightless-1 and LET-60 Ras control germ line morphogenesis in C. elegans. Lu J, Dentler WL, Lundquist EA. BMC Dev Biol. 2008 May 16;8:54. doi: 10.1186/1471-213X-8-54. 10.1186/1471-213X-8-54 PubMed 18485202