REV human OCT4 TALEN
(Plasmid
#52413)
-
PurposeTALEN expressing vector used to allow Knock-in of OCT4-GFP-2A-PURO knockin donor plasmid (generated by Jaenisch lab- Addgene Vector # 31939)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52413 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTal4
-
Modifications to backboneWe have modified pTal4 from Golden Gate TALEN kit by introducing CAGGS promoter (see the map and sequence)
-
Vector typeTALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHD HD HD HD HD NI NG NG HD HD NG NI NN NI NI NN NN
-
SpeciesSynthetic
- Promoter CAGGS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer tgaagattgcaaaacgtggc
- 3′ sequencing primer ctcatcccgaactgcgtcat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
REV human OCT4 TALEN was a gift from Jacob Hanna (Addgene plasmid # 52413 ; http://n2t.net/addgene:52413 ; RRID:Addgene_52413) -
For your References section:
Derivation of novel human ground state naive pluripotent stem cells. Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. 10.1038/nature12745 PubMed 24172903
Map uploaded by the depositor.