pNtCp-rbcL-accD
(Plasmid
#52469)
-
PurposeContains rbcL and accD DNA regions for double homologous recombination useful in Nicotiana tabacum Cp transformation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript II KS+
-
Backbone manufacturerStratagene/GE Health
- Backbone size w/o insert (bp) 2886
- Total vector size (bp) 5652
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerbcL-accd Nicotiana tabacum Cp DNA
-
SpeciesNicotiana tabacum
-
Insert Size (bp)2766
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GCCAGGGTTTTCCCAGTCACGA
- 3′ sequencing primer GAGCGGATAACAATTTCACACAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNtCp-rbcL-accD was a gift from Anastasios Melis (Addgene plasmid # 52469 ; http://n2t.net/addgene:52469 ; RRID:Addgene_52469)