Skip to main content

pNtCp-rbcL-accD
(Plasmid #52469)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52469 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript II KS+
  • Backbone manufacturer
    Stratagene/GE Health
  • Backbone size w/o insert (bp) 2886
  • Total vector size (bp) 5652
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rbcL-accd Nicotiana tabacum Cp DNA
  • Species
    Nicotiana tabacum
  • Insert Size (bp)
    2766

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCCAGGGTTTTCCCAGTCACGA
  • 3′ sequencing primer GAGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNtCp-rbcL-accD was a gift from Anastasios Melis (Addgene plasmid # 52469 ; http://n2t.net/addgene:52469 ; RRID:Addgene_52469)