Skip to main content

pAAV Syn ChR E90R-D156N-T159C 2A tDimer
(Plasmid #52494)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52494 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4606
  • Total vector size (bp) 7012
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use LB Medium
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Channelrhodopsin-2
  • Alt name
    ChR2
  • Alt name
    slow ChloC
  • Species
    Chlamydomonas
  • Insert Size (bp)
    927
  • Mutation
    E90R, D156N, T159C
  • Promoter human synapsin-1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer GATTCTCCTCCACGTCACCGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
    tdimer2(12)
  • Species
    Discosoma sp.
  • Insert Size (bp)
    1395
  • Promoter ribosomal skip sequence

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAGCTCCGGCACCGCCTC
  • 3′ sequencing primer GAGGCGGTGCCGGAGCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    tdimer2 is orignially from Roger Y. Tsien, UCSD ChR2 is from Peter Hegemann, HU Berlin, Germany
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For inhibition of neuronal activity, please consider Addgene Plasmid #66709, a light-gated chloride channel with improved anion selectivity (iChloC)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV Syn ChR E90R-D156N-T159C 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 52494 ; http://n2t.net/addgene:52494 ; RRID:Addgene_52494)
  • For your References section:

    Conversion of Channelrhodopsin into a Light-Gated Chloride Channel. Wietek J, Wiegert JS, Adeishvili N, Schneider F, Watanabe H, Tsunoda SP, Vogt A, Elstner M, Oertner TG, Hegemann P. Science. 2014 Mar 27. 10.1126/science.1249375 PubMed 24674867