This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV Syn ChR E90R-D156N-T159C 2A tDimer
(Plasmid #52494)


Item Catalog # Description Quantity Price (USD)
Plasmid 52494 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4606
  • Total vector size (bp) 7012
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use LB Medium
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
  • Alt name
    slow ChloC
  • Species
  • Insert Size (bp)
  • Mutation
    E90R, D156N, T159C
  • Promoter human synapsin-1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer GATTCTCCTCCACGTCACCGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
  • Species
    Discosoma sp.
  • Insert Size (bp)
  • Promoter ribosomal skip sequence

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAGCTCCGGCACCGCCTC
  • 3′ sequencing primer GAGGCGGTGCCGGAGCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    tdimer2 is orignially from Roger Y. Tsien, UCSD ChR2 is from Peter Hegemann, HU Berlin, Germany
  • Terms and Licenses
  • Article Citing this Plasmid

Depositor Comments

For inhibition of neuronal activity, please consider Addgene Plasmid #66709, a light-gated chloride channel with improved anion selectivity (iChloC)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV Syn ChR E90R-D156N-T159C 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 52494)
  • For your References section:

    Conversion of Channelrhodopsin into a Light-Gated Chloride Channel. Wietek J, Wiegert JS, Adeishvili N, Schneider F, Watanabe H, Tsunoda SP, Vogt A, Elstner M, Oertner TG, Hegemann P. Science. 2014 Mar 27. 10.1126/science.1249375 PubMed 24674867