-
PurposeTALEN-mediated gene editing at human PPP1R12C/AAVS1 locus
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZT
-
Modifications to backboneCompatible with Golden Gate TALEN kit
-
Vector typeMammalian Expression, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRight AAVS1 TALEN
-
SpeciesSynthetic
-
Insert Size (bp)3009
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCGCGAAGAGAGGGGGAGTAAC
- 3′ sequencing primer ACCAAGACATGCCAACGCCACC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pZT-AAVS1-R1 TALEN was assembled using RVD monomers from Golden Gate TALEN kit 1.0 (TALEN Kit #1000000016) and a mammalian TALEN expression vector pZT.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZT-AAVS1-R1 was a gift from Mahendra Rao & Jizhong Zou (Addgene plasmid # 52638 ; http://n2t.net/addgene:52638 ; RRID:Addgene_52638) -
For your References section:
Stable Enhanced Green Fluorescent Protein Expression After Differentiation and Transplantation of Reporter Human Induced Pluripotent Stem Cells Generated by AAVS1 Transcription Activator-Like Effector Nucleases. Luo Y, Liu C, Cerbini T, San H, Lin Y, Chen G, Rao MS, Zou J. Stem Cells Transl Med. 2014 May 15. pii: sctm.2013-0212. 10.5966/sctm.2013-0212 PubMed 24833591