Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #52638)


Item Catalog # Description Quantity Price (USD)
Plasmid 52638 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Modifications to backbone
    Compatible with Golden Gate TALEN kit
  • Vector type
    Mammalian Expression, TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Right AAVS1 TALEN
  • Species
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TCGCGAAGAGAGGGGGAGTAAC
  • 3′ sequencing primer ACCAAGACATGCCAACGCCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pZT-AAVS1-R1 TALEN was assembled using RVD monomers from Golden Gate TALEN kit 1.0 (TALEN Kit #1000000016) and a mammalian TALEN expression vector pZT.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZT-AAVS1-R1 was a gift from Mahendra Rao & Jizhong Zou (Addgene plasmid # 52638 ; ; RRID:Addgene_52638)
  • For your References section:

    Stable Enhanced Green Fluorescent Protein Expression After Differentiation and Transplantation of Reporter Human Induced Pluripotent Stem Cells Generated by AAVS1 Transcription Activator-Like Effector Nucleases. Luo Y, Liu C, Cerbini T, San H, Lin Y, Chen G, Rao MS, Zou J. Stem Cells Transl Med. 2014 May 15. pii: sctm.2013-0212. 10.5966/sctm.2013-0212 PubMed 24833591