Skip to main content

pB-GLUT4-7myc-GFP
(Plasmid #52872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52872 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pB
  • Backbone manufacturer
    Bogan lab, unpublished
  • Backbone size w/o insert (bp) 5783
  • Modifications to backbone
    The vector is based on pMX except that it contains mutations (ATG to GTG) at 1564 and at 1072 to eliminate potential start sites upstream of the cloning site.
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GLUT4
  • Alt name
    SLC2A4
  • Alt name
    solute carrier family 2
  • Species
    R. norvegicus (rat); with human c-terminus
  • Entrez Gene
    Slc2a4 (a.k.a. Glut4)
  • Tags / Fusion Proteins
    • 7x-myc (internal) (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer MX1 CCACCGCCCTCAAAGTAGACG
  • 3′ sequencing primer MX2 CCCCTTTTTCTGGAGACTAAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid is also called pB-G7. We use FACS to select infected cells that express GFP. There is a short linker between GLUT4 and GFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB-GLUT4-7myc-GFP was a gift from Jonathan Bogan (Addgene plasmid # 52872 ; http://n2t.net/addgene:52872 ; RRID:Addgene_52872)
  • For your References section:

    Insulin-responsive compartments containing GLUT4 in 3T3-L1 and CHO cells: regulation by amino acid concentrations. Bogan JS, McKee AE, Lodish HF. Mol Cell Biol. 2001 Jul;21(14):4785-806. 10.1128/MCB.21.14.4785-4806.2001 PubMed 11416153