Skip to main content

pSLfa PUb TAL-KMO-L
(Plasmid #52887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52887 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSLfa
  • Backbone size w/o insert (bp) 4916
  • Total vector size (bp) 7747

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TALEN-KMO
  • Species
    Aedes aegypti
  • Promoter Ae aegypti polyubiquitin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer ATTACTCAAGCGTTTCCTCGT
  • 3′ sequencing primer CTCTACAAATGTGGTATGGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    TALEN was designed and constructed by CELLECTIS BIORESEARCH (France) then cloned into our backbone using standard techniques

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLfa PUb TAL-KMO-L was a gift from Zach Adelman (Addgene plasmid # 52887 ; http://n2t.net/addgene:52887 ; RRID:Addgene_52887)
  • For your References section:

    TALEN-based gene disruption in the dengue vector Aedes aegypti. Aryan A, Anderson MA, Myles KM, Adelman ZN. PLoS One. 2013;8(3):e60082. doi: 10.1371/journal.pone.0060082. Epub 2013 Mar 21. 10.1371/journal.pone.0060082 PubMed 23555893
Commonly requested with: