Skip to main content

pHL 1916
(Plasmid #53023)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53023 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Backbone manufacturer
    Lim lab
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    fimB
  • Species
    E.coli
  • Promoter pLtetO-1
  • Tags / Fusion Proteins
    • RBS(st7) (N terminal on insert)
    • Asp terminator (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer unknown
  • 3′ sequencing primer AspTerm ACTGCTCACAAGAAAAAAGGCACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL 1916 was a gift from Han Lim (Addgene plasmid # 53023 ; http://n2t.net/addgene:53023 ; RRID:Addgene_53023)
  • For your References section:

    Modulating the frequency and bias of stochastic switching to control phenotypic variation. Hung M, Chang E, Hussein R, Frazier K, Shin JE, Sagawa S, Lim HN. Nat Commun. 2014 Aug 4;5:4574. doi: 10.1038/ncomms5574. 10.1038/ncomms5574 PubMed 25087841