pHL 1916
(Plasmid
#53023)
-
PurposeAmpR + PLtetO-1::RBS (st7) fimB::Asp terminator + ColE1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneunknown
-
Backbone manufacturerLim lab
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefimB
-
SpeciesE.coli
- Promoter pLtetO-1
-
Tags
/ Fusion Proteins
- RBS(st7) (N terminal on insert)
- Asp terminator (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer unknown
- 3′ sequencing primer AspTerm ACTGCTCACAAGAAAAAAGGCACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHL 1916 was a gift from Han Lim (Addgene plasmid # 53023 ; http://n2t.net/addgene:53023 ; RRID:Addgene_53023) -
For your References section:
Modulating the frequency and bias of stochastic switching to control phenotypic variation. Hung M, Chang E, Hussein R, Frazier K, Shin JE, Sagawa S, Lim HN. Nat Commun. 2014 Aug 4;5:4574. doi: 10.1038/ncomms5574. 10.1038/ncomms5574 PubMed 25087841