Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAC-VIOL
(Plasmid #53087)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53087 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAC-ZEAXipi
  • Backbone manufacturer
    Francis X. Cunningham, Jr.
  • Backbone size w/o insert (bp) 10040
  • Total vector size (bp) 12814
  • Modifications to backbone
    An Arabidopsis thaliana cDNA encoding zeaxanthin epoxidase (zep) was modified so as to delete codons for the first 60 amino acids (the putative chloroplast transit sequence) and cloned in the NdeI and XhoI sites of pET30C so that expression was under the control of the T7 promoter. This plasmid, pET-AtZEP (unpublished), was a gift of Dr. Martin Sergeant, at that time at the University of Warwick. The zep gene with T7 promoter were excised from pET-AtZEP as a Klenow-blunted BspHI-BspHI fragment of ca. 2.4 kB and cloned in the Klenow-blunted AseI site of pAC-ZEAXipi. Insert orientation and sequences at the junctions of the insert were confirmed by DNA sequencing.
  • Vector type
    low copy number bacterial cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Top10
  • Growth instructions
    Grow liquid cultures at 28 degrees Celsius for 2-3 days for best violaxanthin production, or grow on agar plates at room temperature for 3-7 days.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    zep
  • Alt name
    zeaxanthin epoxidase
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2774
  • Mutation
    Lacks codons for the first 60 N-terminal amino acids that are thought to comprise the chloroplast transit sequence
  • GenBank ID
    AF281655.1
  • Entrez Gene
    ABA1 (a.k.a. AT5G67030, ABA DEFICIENT 1, ARABIDOPSIS THALIANA ABA DEFICIENT 1, ARABIDOPSIS THALIANA ZEAXANTHIN EPOXIDASE, ATABA1, ATZEP, IBS3, IMPAIRED IN BABA-INDUCED STERILITY 3, K8A10.10, K8A10_10, LOS6, LOW EXPRESSION OF OSMOTIC STRESS-RESPONSIVE GENES 6, NON-PHOTOCHEMICAL QUENCHING 2, NPQ2, ZEAXANTHIN EPOXIDASE, ZEP)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AseI (destroyed during cloning)
  • 3′ cloning site AseI (destroyed during cloning)
  • 5′ sequencing primer tagccgctaaagcaaacacc
  • 3′ sequencing primer gatggatcttcgaagcgaac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid pET-AtZEP, containing a truncated Arabidopsis thaliana zep cDNA under the control of the T7 promoter, was a gift of Dr. Martin Sergeant, at that time of the University of Warwick.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

For better yield of low copy number pAC-based plasmids, grow liquid cultures on a platform shaker at ca. 30 degrees Celsius. When cultures reach early stationary phase, dilute 2-fold with growth medium, add spectinomycin (150 mg/liter), and "amplify" for several hours before harvest. For plasmid selection and maintenance in E. coli, use chloramphenicol at 30 mg/liter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC-VIOL was a gift from Francis X Cunningham Jr (Addgene plasmid # 53087 ; http://n2t.net/addgene:53087 ; RRID:Addgene_53087)
  • For your References section:

    The tomato mutation nxd1 reveals a gene necessary for neoxanthin biosynthesis and demonstrates that violaxanthin is a sufficient precursor for abscisic acid biosynthesis. Neuman H, Galpaz N, Cunningham FX Jr, Zamir D, Hirschberg J. Plant J. 2014 Apr;78(1):80-93. doi: 10.1111/tpj.12451. Epub 2014 Mar 12. 10.1111/tpj.12451 PubMed 24506237