Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

JF001A
(Plasmid #53116)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53116 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET21b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5442
  • Total vector size (bp) 6278
  • Modifications to backbone
    lacO and original RBS were removed from pET21b and substituted with the theophylline riboswitch
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    theophylline riboswitch and alpha hemolysin
  • Alt name
    alpha hemolysin from Staphylococcus aureus
  • Alt name
    αHL
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    939
  • Promoter T7 promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGCAGCACCCTGCTAAGGTAACAACAAG ATGGATTCTGATATCAATATCAAAACC
  • 3′ sequencing primer AAG GGC ATC AAG ACG ATG CTG GTA TCA CCC TAT AGT GAG TCG TAT TAA TTT CGC GG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JF001A was a gift from Sheref Mansy (Addgene plasmid # 53116 ; http://n2t.net/addgene:53116 ; RRID:Addgene_53116)
  • For your References section:

    Integrating artificial with natural cells to translate chemical messages that direct E. coli behaviour. Lentini R, Santero SP, Chizzolini F, Cecchi D, Fontana J, Marchioretto M, Del Bianco C, Terrell JL, Spencer AC, Martini L, Forlin M, Assfalg M, Dalla Serra M, Bentley WE, Mansy SS. Nat Commun. 2014 May 30;5:4012. doi: 10.1038/ncomms5012. 10.1038/ncomms5012 PubMed 24874202