pGfa2-EGFP
(Plasmid #53128)

• Purpose: Expression of EGFP in mouse astrocytes
• Depositing Lab: Michael Brenner
• Publication: Brenner lab unpublished plasmids (unpublished)

Backbone

• Vector backbone: pGfa2-cLac
• Backbone manufacturer: Brenner Lab
• Vector type: Mammalian Expression, Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gfa2
• Alt name: glial fibrillary acidic protein
• Alt name: GFAP
• Species: H. sapiens (human)
• Mutation: contains -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG
• Entrez Gene: GFAP (a.k.a. ALXDRD)
• Promoter: human Gfa2
• Tags / Fusion Proteins:
  • EGFP (C terminal on insert)
  • mP1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: MB-351 CATCGCCAGTCTAGCCCACTCCT
• 3′ sequencing primer: MB-352 GACGTTGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pGfa2-EGFP sequence with annotations

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was made by digesting pGfa2-cLac with BamHI to remove the lacZ gene (digestion of pGfa2-nLac would produce the same recipient), blunt ending by filling in, and inserting the SmaI/StuI fragment from Clontech's pEGFP that contains the EGFP coding region. The first two bases from each of the filled in BamHI sites were lost during the construction.