Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGfa2-EGFP
(Plasmid #53128)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53128 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGfa2-cLac
  • Backbone manufacturer
    Brenner Lab
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gfa2
  • Alt name
    glial fibrillary acidic protein
  • Alt name
    GFAP
  • Species
    H. sapiens (human)
  • Mutation
    contains -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)
  • Promoter human Gfa2
  • Tags / Fusion Proteins
    • EGFP (C terminal on insert)
    • mP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
  • 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was made by digesting pGfa2-cLac with BamHI to remove the lacZ gene (digestion of pGfa2-nLac would produce the same recipient), blunt ending by filling in, and inserting the SmaI/StuI fragment from Clontech's pEGFP that contains the EGFP coding region. The first two bases from each of the filled in BamHI sites were lost during the construction.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGfa2-EGFP was a gift from Michael Brenner (Addgene plasmid # 53128 ; http://n2t.net/addgene:53128 ; RRID:Addgene_53128)