Skip to main content

pGfa2-nLac
(Plasmid #53126)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53126 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pUC18
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gfa2
  • Alt name
    glial fibrillary acidic protein
  • Alt name
    GFAP
  • Species
    H. sapiens (human)
  • Mutation
    contains -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)
  • Promoter human GFAP
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • LacZ (C terminal on insert)
    • mP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
  • 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is a pUC18 vector containing the human GFAP sequences from -2163 to +47 (the human gfa2 segment), with the initiating ATG mutated to TTG, placed in front of the nuclear targeted E. coli lacZ gene, which in turn is followed by a fragment of the mouse protamine-1 gene. The latter supplies an intron, stabilizing 3' UTR, and a polyadenylation signal. If cloning a cDNA, it is advisable to retain the mP-1 segment. The lacZ gene can be excised by digestion with BamHI, and replaced with your gene of interest. If cloning a genomic sequence that includes an intron and polyadenylation site (this may compromise astrocyte specificity--see Su et al. 2004), the mP-1 region can also be excised, or alternatively, a number of sites flank the gfa2 segment allowing its isolation.

Restriction sites that may be useful are as follows:

EcoRI: flanks the gfa2, lacZ, and mP-1 segments
Bgl II: 5' flank of gfa2 & 3' flank of mP-1
Bam HI: flanks the lacZ gene
Sal I: cuts uniquely between the gfa2 promoter and the LacZ gene
Sph I and Hind III: cut uniquely just 3' of the mP-1 segment

Although the GFAP promoter appears to be the best choice for targeting transgene expression to astrocytes in mice, please be aware that neuronal expression has also occasionally been observed (Su et al. 2004).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGfa2-nLac was a gift from Michael Brenner (Addgene plasmid # 53126 ; http://n2t.net/addgene:53126 ; RRID:Addgene_53126)
  • For your References section:

    GFAP promoter directs astrocyte-specific expression in transgenic mice. Brenner M, Kisseberth WC, Su Y, Besnard F, Messing A. J Neurosci. 1994 Mar;14(3 Pt 1):1030-7. PubMed 8120611