Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGfa2(ABDx3)-nLac
(Plasmid #53133)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53133 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gfa2
  • Alt name
    glial fibrillary acidic protein
  • Alt name
    GFAP
  • Species
    H. sapiens (human)
  • Mutation
    -2163 to +47, with 3 copies of 3 copies of the gfa28 ABD segment inserted into the Sma I site just upstream of the basal promoter, with the initiating ATG mutated to TTG
  • Entrez Gene
    GFAP (a.k.a. ALXDRD)
  • Promoter human Gfa2
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • LacZ (C terminal on insert)
    • mP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer MB-351 CATCGCCAGTCTAGCCCACTCCT
  • 3′ sequencing primer MB-352 GACGTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid is a variant of pGfa2-nLac (Addgene plasmid #53126)constructed by inserting 3 copies of the gfa28 ABD segment [Besnard et al., (1991) J Biol Chem 266: 18877-18883] into the Sma I site just upstream of the basal promoter. It has about 100 times higher activity than pGfa2-nLac in transfected cells, but does not work in transgenic mice; possibly the high level of expression it produces is toxic.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGfa2(ABDx3)-nLac was a gift from Michael Brenner (Addgene plasmid # 53133 ; http://n2t.net/addgene:53133 ; RRID:Addgene_53133)
  • For your References section:

    Increased glia-specific transgene expression with glial fibrillary acidic protein promoters containing multiple enhancer elements. de Leeuw B, Su M, ter Horst M, Iwata S, Rodijk M, Hoeben RC, Messing A, Smitt PS, Brenner M. J Neurosci Res. 2006 Apr;83(5):744-53. 10.1002/jnr.20776 PubMed 16496373