pGfa(B3)-nLac
(Plasmid #53132)

• Purpose: expression of nuclear LacZ driven by Gfa2 promoter with 3 additional B sites, has about 75 times higher activity than pGfa2-nLac in transfected cells
• Depositing Lab: Michael Brenner
• Depositing Organization: National Institute of Neurological Disorders and Strokes (NINDS)
  Located in United States of America
• Publication: de Leeuw et al J Neurosci Res. 2006 Apr;83(5):744-53.

Backbone

• Vector backbone: pUC18
• Vector type: Mammalian Expression, Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gfa2
• Alt name: glial fibrillary acidic protein
• Alt name: GFAP
• Species: H. sapiens (human)
• Mutation: -2163 to +47, with 3 copies of the gfa2 B segment inserted into the Sma I site just upstream of the basal promoter, with the initiating ATG mutated to TTG
• Entrez Gene: GFAP (a.k.a. ALXDRD)
• Promoter: human Gfa2
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • LacZ (C terminal on insert)
  • mP1 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: MB-351 CATCGCCAGTCTAGCCCACTCCT
• 3′ sequencing primer: MB-352 GACGTTGTAAAACGACGGCCAGT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is a variant of pGfa2-nLac (Addgene plasmid #53126) constructed by inserting 3 copies of the gfa2 B segment (Besnard et al. 1991) into the Sma I site just upstream of the basal promoter. It has about 75 times higher activity than pGfa2-nLac in transfected cells, but does not work in transgenic mice; possibly the high level of expression it produces is toxic.

DNA (Catalog # 53132-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 53132-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.