Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #53168)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 53168 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    GE Healthcare
  • Backbone size w/o insert (bp) 4984
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Dual specificity mitogen-activated protein kinase kinase 5
  • Alt name
    MAPK/ERK kinase 5
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Entrez Gene
    MAP2K5 (a.k.a. HsT17454, MAPKK5, MEK5, PRKMK5)
  • Tags / Fusion Proteins
    • GST (N terminal on backbone)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene Plasmid 20514: pWZL Neo Myr Flag MAP2K5
  • Terms and Licenses

Depositor Comments

The sequence discrepancies found during the QC process have no functional consequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX6P1-HA-MEK5 CBM-E was a gift from Christopher Counter (Addgene plasmid # 53168 ; ; RRID:Addgene_53168)
  • For your References section:

    Copper is required for oncogenic BRAF signalling and tumorigenesis. Brady DC, Crowe MS, Turski ML, Hobbs GA, Yao X, Chaikuad A, Knapp S, Xiao K, Campbell SL, Thiele DJ, Counter CM. Nature. 2014 Apr 9. doi: 10.1038/nature13180. 10.1038/nature13180 PubMed 24717435