Skip to main content
Addgene

pBABEpuro-CMYC T58A
(Plasmid #53178)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53178 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBABE puro
  • Backbone size w/o insert (bp) 5169
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CMYC
  • Alt name
    Myc proto oncogene protein
  • Alt name
    Oncogene myc
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1364
  • Mutation
    T58A
  • GenBank ID
  • Entrez Gene
    Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTTTATCCAGCCCTCAC
  • 3′ sequencing primer ACCCTAACTGACACACATTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The mutations found during the QC process have no functional consequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBABEpuro-CMYC T58A was a gift from Christopher Counter (Addgene plasmid # 53178)
  • For your References section:

    Copper is required for oncogenic BRAF signalling and tumorigenesis. Brady DC, Crowe MS, Turski ML, Hobbs GA, Yao X, Chaikuad A, Knapp S, Xiao K, Campbell SL, Thiele DJ, Counter CM. Nature. 2014 Apr 9. doi: 10.1038/nature13180. 10.1038/nature13180 PubMed 24717435