pIND-CLucZ
(Plasmid
#53224)
-
PurposeInducible expression of Cypridina luciferase and shRNAmir of interest
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepINDUCER10-PheS
-
Backbone manufacturerStephen Elledge
- Total vector size (bp) 14250
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCypridina luciferase
-
Alt nameCLuc
-
SpeciesCypridina noctiluca
-
Insert Size (bp)1700
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GAAGTTGGAACTGTGTTTGGTGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namenon-silencing shRNA
-
Alt namensh
-
SpeciesSynthetic
-
Insert Size (bp)110
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATCAAAGAGATAGCAAGGTATTCAGTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCypridina Luciferase (CLuc) was taken from the pCLuc-Basic 2 Vector (N0317S) from New England Biolabs.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIND-CLucZ was a gift from Thorsten Stiewe (Addgene plasmid # 53224 ; http://n2t.net/addgene:53224 ; RRID:Addgene_53224) -
For your References section:
Monitoring the dynamics of clonal tumour evolution in vivo using secreted luciferases. Charles JP, Fuchs J, Hefter M, Vischedyk JB, Kleint M, Vogiatzi F, Schafer JA, Nist A, Timofeev O, Wanzel M, Stiewe T. Nat Commun. 2014 Jun 3;5:3981. doi: 10.1038/ncomms4981. 10.1038/ncomms4981 PubMed 24889111