-
PurposeConstitutive expression of Cypridina luciferase, puromycin N-acetyl-transferase and shRNAmir of interest
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGIPZ
-
Backbone manufacturerOpen Biosystems
- Total vector size (bp) 12370
-
Modifications to backboneDeletion of an EcoRI site in the Hygromycin resistance gene
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCypridina luciferase
-
Alt nameCLuc
-
SpeciesCypridina noctiluca
-
Insert Size (bp)1662
Gene/Insert 2
-
Gene/Insert namenon-silencing shRNA
-
Alt namensh
-
Insert Size (bp)110
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATCAAAGAGATAGCAAGGTATTCAGTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCypridina Luciferase (CLuc) was taken from the pCLuc-Basic 2 Vector (N0317S) from New England Biolabs.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCLucIPZ was a gift from Thorsten Stiewe (Addgene plasmid # 53222 ; http://n2t.net/addgene:53222 ; RRID:Addgene_53222) -
For your References section:
Monitoring the dynamics of clonal tumour evolution in vivo using secreted luciferases. Charles JP, Fuchs J, Hefter M, Vischedyk JB, Kleint M, Vogiatzi F, Schafer JA, Nist A, Timofeev O, Wanzel M, Stiewe T. Nat Commun. 2014 Jun 3;5:3981. doi: 10.1038/ncomms4981. 10.1038/ncomms4981 PubMed 24889111