pZS*11-yfp0
(Plasmid
#53241)
-
Purposeexpress yellow fluorescent protein (YFP) with strong T7 RBS at a low gene dosage (3-4 copies/cell)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepzs*11
-
Backbone manufacturerLutz and Bujard 1997
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4353
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)MG1655 but can be expressed in any strain
-
Growth instructionsNormally the YFP production is constitutive. If grown in a strain with tet repressor, need to add 200ng/ul of anhydrotetracyline for full induction of YFP.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameYFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter PLtetO1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CACCTCGAGTCCCTATCAGTG
- 3′ sequencing primer CCTGAAGCCGGATCTGCGATTCTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZS*11-yfp0 was a gift from Philippe Cluzel (Addgene plasmid # 53241 ; http://n2t.net/addgene:53241 ; RRID:Addgene_53241) -
For your References section:
Environmental perturbations lift the degeneracy of the genetic code to regulate protein levels in bacteria. Subramaniam AR, Pan T, Cluzel P. Proc Natl Acad Sci U S A. 2013 Feb 5;110(6):2419-24. doi: 10.1073/pnas.1211077110. Epub 2012 Dec 31. 10.1073/pnas.1211077110 PubMed 23277573