pEntry Tshld(FKBP F36V)-GFP
(Plasmid #53260)

• Purpose: pEntry Tshld(FKBP F36V)-GFP is a product of BP recombination reaction between attB flanked Tshld(F36V) system-encoded PCR product and pDonor 201 plasmid.
• Depositing Lab: Matthew Pratt
• Depositing Organization: University of Southern California
  Located in United States of America
• Publication: Lin et al Chembiochem. 2014 Mar 11. doi: 10.1002/cbic.201400006.

Backbone

• Vector backbone: pDONR 201
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 4470
• Total vector size (bp): 4073
• Modifications to backbone: Note that the insert was introduced by BP recombination reaction

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tshld(FKBP F36V)-GFP
• Alt name: FLAG tag-FRB-UbN(I13G)-T2A-FKBP*(F36V)-UbC-HA tag-GFP
• Mutation: FKBP F36V
• Tags / Fusion Proteins:
  • Flag (N terminal on insert)
  • HA (C terminal on insert)
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCGCGTTAACGCTAGCATGGATCTC
• 3′ sequencing primer: GTAACATCAGAGATTTTGAGACAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Tshld(FKBP F36V) system allows users to fine-tune the concentration of a protein of interest in mammalian cells by titrating the concentration of non-toxic small molecule Shld1. Unlike other post-translational techniques, the Tshld(FKBP F36V) system releases its protein of interest in its native form, so it is highly attractive to be used in investigations of proteins involved in multimeric protein complexes.

DNA (Catalog # 53260-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 53260-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.