-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15885 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSG5
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5100
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5 alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse vasa promoter
-
Alt nameDEAD (Asp-Glu-Ala-Asp) box polypeptide 4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)5600
-
GenBank IDNC_000079
-
Entrez GeneDdx4 (a.k.a. AV206478, Mv, Mvh, VASA)
-
Tag
/ Fusion Protein
- Cre (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TGTGCCACCATGCCTGGCCCAGTTTC
- 3′ sequencing primer TCTCCGCTCCAGGCTCCCCGGGCTCCT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sequence the lab cloned is somewhat different from the NCBI sequence. This could be explained by different strains, etc., since they cloned the promoter from the FVB strain whereas the NCBI genome sequence is C57Bl6. Since the plasmid has been shown to be functional in transgenic mice, the depositing lab does not believe this represents a problem.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVasa-Cre was a gift from Diego Castrillon (Addgene plasmid # 15885 ; http://n2t.net/addgene:15885 ; RRID:Addgene_15885) -
For your References section:
Generation of a germ cell-specific mouse transgenic Cre line, Vasa-Cre. Gallardo T, Shirley L, John GB, Castrillon DH. Genesis. 2007 Jun . 45(6):413-7. 10.1002/dvg.20310 PubMed 17551945