Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pVasa-Cre
(Plasmid #15885)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 15885 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSG5
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5100
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5 alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse vasa promoter
  • Alt name
    DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    5600
  • GenBank ID
    NC_000079
  • Entrez Gene
    Ddx4 (a.k.a. AV206478, Mvh, VASA)
  • Tag / Fusion Protein
    • Cre (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TGTGCCACCATGCCTGGCCCAGTTTC
  • 3′ sequencing primer TCTCCGCTCCAGGCTCCCCGGGCTCCT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The sequence the lab cloned is somewhat different from the NCBI sequence. This could be explained by different strains, etc., since they cloned the promoter from the FVB strain whereas the NCBI genome sequence is C57Bl6. Since the plasmid has been shown to be functional in transgenic mice, the depositing lab does not believe this represents a problem.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVasa-Cre was a gift from Diego Castrillon (Addgene plasmid # 15885 ; http://n2t.net/addgene:15885 ; RRID:Addgene_15885)
  • For your References section:

    Generation of a germ cell-specific mouse transgenic Cre line, Vasa-Cre. Gallardo T, Shirley L, John GB, Castrillon DH. Genesis. 2007 Jun . 45(6):413-7. 10.1002/dvg.20310 PubMed 17551945