Skip to main content
Addgene

pBR322-MCK1.35lux
(Plasmid #53368)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53368 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR322
  • Backbone size w/o insert (bp) 4361
  • Total vector size (bp) 6150
  • Modifications to backbone
    Amp resistance gene and origin of replication from pBR322. MCK 1.35 promoter/enhancer can be excised with AatII or NdeI at 5', and HindIII or EcoRI at 3' end. Luciferase gene (Photinus pyralis). SV40 pA.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    muscle creatine kinase promoter/enhancer 1.35kb
  • Alt name
    MCK1.35
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1354

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI, AatII (not destroyed)
  • 3′ cloning site HindIII, EcoRI (not destroyed)
  • 5′ sequencing primer CTGTCATGCCATCCGTAAGA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBR322-MCK1.35lux was a gift from Josephine Nalbantoglu (Addgene plasmid # 53368 ; http://n2t.net/addgene:53368 ; RRID:Addgene_53368)
  • For your References section:

    Efficient muscle-specific transgene expression after adenovirus-mediated gene transfer in mice using a 1.35 kb muscle creatine kinase promoter/enhancer. Larochelle N, Lochmuller H, Zhao J, Jani A, Hallauer P, Hastings KE, Massie B, Prescott S, Petrof BJ, Karpati G, Nalbantoglu J. Gene Ther. 1997 May;4(5):465-72. 10.1038/sj.gt.3300414 PubMed 9274724