Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pXylA-agrCA-I
(Plasmid #53437)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53437 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT7-RNAP
  • Backbone manufacturer
    MoBiTec
  • Backbone size w/o insert (bp) 8812
  • Total vector size (bp) 8209
  • Modifications to backbone
    The T7 rnap gene was replaced by the type-I agrCA genes of S. aureus (cloned out of the pAgrC1agrA plasmid)
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    MS941 E. coli is used for expression. pT7-RNAP contains the genes of ampicillin and chloramphenicol for easy selection in E. coli (AmpR) and B. megaterium (CmR).
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    agrCA locus
  • Species
    S. aureus
  • Insert Size (bp)
    2065
  • Mutation
    "MVQTS" sequence added to the N-terminus of AgrC
  • Promoter PxylA
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer 5' - ccactcctttgtttatccaccg - 3'
  • 3′ sequencing primer 5' - agtacaaccaagagaacggaggc - 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We received the pAgrC1agrA plasmid from Paul Williams lab (ref: Jensen et al. J. Mol. Biol. 2008).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXylA-agrCA-I was a gift from Cynthia Collins (Addgene plasmid # 53437 ; http://n2t.net/addgene:53437 ; RRID:Addgene_53437)
  • For your References section:

    Peptide-based communication system enables Escherichia coli to Bacillus megaterium interspecies signaling. Marchand N, Collins CH. Biotechnol Bioeng. 2013 Nov;110(11):3003-12. doi: 10.1002/bit.24975. Epub 2013 Jul 5. 10.1002/bit.24975 PubMed 23775238