pP3-GFP
(Plasmid #53436)

• Purpose: Controls GFP expression from the P3 promoter cloned out of S. aureus RN4220 genome
• Depositing Lab: Cynthia Collins
• Publication: Marchand et al Biotechnol Bioeng. 2013 Nov;110(11):3003-12. doi: 10.1002/bit.24975. Epub 2013 Jul 5.

Backbone

• Vector backbone: pPT7-GFP
• Backbone manufacturer: MoBiTec
• Backbone size w/o insert (bp): 5946
• Total vector size (bp): 6068
• Modifications to backbone: T7 promoter replaced by the P3 promoter from the genome of S. aureus RN4220
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: MS941 E. coli is used for expression.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: P3 promoter
• Species: S. aureus
• Insert Size (bp): 172
• Mutation: none
• Promoter: P3
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: 5' - tccctgatctcgacttcgttc - 3'
• 3′ sequencing primer: 5' - tggtttgcgcattcacagttctcc - 3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry