-
PurposeControls GFP expression from the P3 promoter cloned out of S. aureus RN4220 genome
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPT7-GFP
-
Backbone manufacturerMoBiTec
- Backbone size w/o insert (bp) 5946
- Total vector size (bp) 6068
-
Modifications to backboneT7 promoter replaced by the P3 promoter from the genome of S. aureus RN4220
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMS941 E. coli is used for expression.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameP3 promoter
-
SpeciesS. aureus
-
Insert Size (bp)172
-
Mutationnone
- Promoter P3
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer 5' - tccctgatctcgacttcgttc - 3'
- 3′ sequencing primer 5' - tggtttgcgcattcacagttctcc - 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pP3-GFP was a gift from Cynthia Collins (Addgene plasmid # 53436 ; http://n2t.net/addgene:53436 ; RRID:Addgene_53436) -
For your References section:
Peptide-based communication system enables Escherichia coli to Bacillus megaterium interspecies signaling. Marchand N, Collins CH. Biotechnol Bioeng. 2013 Nov;110(11):3003-12. doi: 10.1002/bit.24975. Epub 2013 Jul 5. 10.1002/bit.24975 PubMed 23775238