This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pYLL204
(Plasmid #53455)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53455 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 4095
  • Total vector size (bp) 9045
  • Modifications to backbone
    DNA sequence deleted between Cla1 and Xba1 in Polylinker 1.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HA-tagged Mus musculus topoisomerase (DNA) II beta (Top2b) Y814F
  • Alt name
    HA-mTop2bY814F
  • Alt name
    Top2b Y814F
  • Alt name
    topoisomerase (DNA) II beta Y814F
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4873
  • Mutation
    Y814F
  • GenBank ID
    NM_009409
  • Entrez Gene
    Top2b (a.k.a. D230016L12Rik, Top-2)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Cla1 (not destroyed)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer TTGTGGGCAGTAATAACATTAAC
  • 3′ sequencing primer AATACCCTCAGCACCATTAATC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

The Y814F mutation was introduced by PCR-mediated mutagenesis. The PCR primer contains the A to T point mutation at the nucleotide position 2441 of the mouse Top2b cDNA.

Addgene QC sequencing found an A253V mutation, it should not effect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYLL204 was a gift from Leroy Liu & Lisa Lyu (Addgene plasmid # 53455 ; http://n2t.net/addgene:53455 ; RRID:Addgene_53455)
  • For your References section:

    Activation of a novel ubiquitin-independent proteasome pathway when RNA polymerase II encounters a protein roadblock. Ban Y, Ho CW, Lin RK, Lyu YL, Liu LF. Mol Cell Biol. 2013 Oct;33(20):4008-16. doi: 10.1128/MCB.00403-13. Epub 2013 Aug 12. 10.1128/MCB.00403-13 PubMed 23938298