pYLL204
(Plasmid #53455)

• Purpose: Expresses active site tyrosine mutated HA-tagged mouse DNA topoisomerase IIbeta Y814F (full length cDNA, in pCS2+ backbone)
• Depositing Labs: Leroy Liu, Lisa Lyu
• Publication: Ban et al Mol Cell Biol. 2013 Oct;33(20):4008-16. doi: 10.1128/MCB.00403-13. Epub 2013 Aug 12.

Backbone

• Vector backbone: pCS2+
• Backbone size w/o insert (bp): 4095
• Total vector size (bp): 9045
• Modifications to backbone: DNA sequence deleted between Cla1 and Xba1 in Polylinker 1.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: HA-tagged Mus musculus topoisomerase (DNA) II beta (Top2b) Y814F
• Alt name: HA-mTop2bY814F
• Alt name: Top2b Y814F
• Alt name: topoisomerase (DNA) II beta Y814F
• Species: M. musculus (mouse)
• Insert Size (bp): 4873
• Mutation: Y814F
• GenBank ID: NM_009409
• Entrez Gene: Top2b (a.k.a. D230016L12Rik, Top-2)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Cla1 (not destroyed)
• 3′ cloning site: Xba1 (not destroyed)
• 5′ sequencing primer: TTGTGGGCAGTAATAACATTAAC
• 3′ sequencing primer: AATACCCTCAGCACCATTAATC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Y814F mutation was introduced by PCR-mediated mutagenesis. The PCR primer contains the A to T point mutation at the nucleotide position 2441 of the mouse Top2b cDNA.

Addgene QC sequencing found an A253V mutation, it should not effect the function of the plasmid.