-
Purposeexpress FLAG-tagged human UbxD8 gene
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRK5
- Backbone size w/o insert (bp) 4353
- Total vector size (bp) 5700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUbxD8
-
Alt nameFAF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1350
-
GenBank IDNP_055428
-
Entrez GeneFAF2 (a.k.a. ETEA, UBXD8, UBXN3B)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACGCGTCGACC atgaccgaaatgagcttcctgagc
- 3′ sequencing primer ATAGTTTAGCGGCCGC ctaggggacccttttcttccc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOrigene
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK-FLAG-UbxD8 was a gift from Yihong Ye (Addgene plasmid # 53777 ; http://n2t.net/addgene:53777 ; RRID:Addgene_53777) -
For your References section:
A ubiquitin-like domain recruits an oligomeric chaperone to a retrotranslocation complex in endoplasmic reticulum-associated degradation. Xu Y, Liu Y, Lee JG, Ye Y. J Biol Chem. 2013 Jun 21;288(25):18068-76. doi: 10.1074/jbc.M112.449199. Epub 2013 May 12. 10.1074/jbc.M112.449199 PubMed 23665563