Skip to main content

pmcherry-LCa
(Plasmid #53972)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53972 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmCherry-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4722
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    clathrin light chain
  • Species
    R. norvegicus (rat)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga)
  • 3′ sequencing primer SV40pA-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmcherry-LCa was a gift from Tom Kirchhausen (Addgene plasmid # 53972 ; http://n2t.net/addgene:53972 ; RRID:Addgene_53972)
  • For your References section:

    Dynamics of intracellular clathrin/AP1- and clathrin/AP3-containing carriers. Kural C, Tacheva-Grigorova SK, Boulant S, Cocucci E, Baust T, Duarte D, Kirchhausen T. Cell Rep. 2012 Nov 29;2(5):1111-9. doi: 10.1016/j.celrep.2012.09.025. Epub 2012 Oct 25. 10.1016/j.celrep.2012.09.025 PubMed 23103167