-
PurposeExpresses the light chain of clathrin
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmCherry-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4722
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameclathrin light chain
-
SpeciesR. norvegicus (rat)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga)
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmcherry-LCa was a gift from Tom Kirchhausen (Addgene plasmid # 53972 ; http://n2t.net/addgene:53972 ; RRID:Addgene_53972) -
For your References section:
Dynamics of intracellular clathrin/AP1- and clathrin/AP3-containing carriers. Kural C, Tacheva-Grigorova SK, Boulant S, Cocucci E, Baust T, Duarte D, Kirchhausen T. Cell Rep. 2012 Nov 29;2(5):1111-9. doi: 10.1016/j.celrep.2012.09.025. Epub 2012 Oct 25. 10.1016/j.celrep.2012.09.025 PubMed 23103167