-2.5Kb MMP10
(Plasmid
#53973)
-
PurposeLuciferase reporter for mouse MMP10 2.5kb promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 7303
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse MMP10 2.5Kb promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2500
-
GenBank ID
-
Entrez GeneMmp10 (a.k.a. AV377895, MMP-10, SL-2)
- Promoter PCR from C57BL6/J
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
-2.5Kb MMP10 was a gift from Michael Chin (Addgene plasmid # 53973 ; http://n2t.net/addgene:53973 ; RRID:Addgene_53973) -
For your References section:
Regulation of MMP10 expression by the transcription factor CHF1/Hey2 is mediated by multiple E boxes. Wu L, Chien WM, Hartman ME, Moussavi-Harami F, Liu Y, Chin MT. Biochem Biophys Res Commun. 2011 Dec 2;415(4):662-8. doi: 10.1016/j.bbrc.2011.10.132. Epub 2011 Nov 3. 10.1016/j.bbrc.2011.10.132 PubMed 22079635