-2.5Kb MMP10
(Plasmid #53973)

• Purpose: Luciferase reporter for mouse MMP10 2.5kb promoter
• Depositing Lab: Michael Chin
• Publication: Wu et al Biochem Biophys Res Commun. 2011 Dec 2;415(4):662-8. doi: 10.1016/j.bbrc.2011.10.132. Epub 2011 Nov 3.

Backbone

• Vector backbone: pGL3-Basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 7303
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mouse MMP10 2.5Kb promoter
• Species: M. musculus (mouse)
• Insert Size (bp): 2500
• GenBank ID:
• Entrez Gene: Mmp10 (a.k.a. AV377895, MMP-10, SL-2)
• Promoter: PCR from C57BL6/J

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CTAGCAAAATAGGCTGTCCC
• 3′ sequencing primer: CTTTATGTTTTTGGCGTCTTCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry