pCRUSH
(Plasmid
#54480)
-
Purpose(Empty Backbone) Mouse genomic ROSA26 targeting vector, expresses EGFP, cre/lox conditional U6 promoter pgk-puro
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 54480 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneROSA26-1
-
Backbone manufacturerPhil Soriano, Addgene Plasmid #21714
-
Modifications to backboneModified by deleting the HpaI site, converting the XhoI site to AscI, and cloning a splice acceptor-GFP-polyA into the XbaI site. Cre-lox regulated U6 cassette derived from pSICO PGK puro, Addgene plasmid 11586, (Ventura et al., 2004) was modified by replacing the lentiviral GFP gene with drug selection markers (pgk-puro), and cloned into the XbaI site 3' of GFP. Unique HpaI and XhoI sites were maintained for single step short hairpin oligonucleotide cloning.
-
Vector typeMammalian Expression, Mouse Targeting, RNAi, Cre/Lox
- Promoter U6
-
Selectable markersPuromycin
-
Tags
/ Fusion Proteins
- SA-EGFP-polyA (N terminal on backbone)
- U6 promoter (N terminal on backbone)
- loxP (N terminal on backbone)
- pgk-puro (N terminal on backbone)
- loxP (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CRUSH-for CATCAGAAGCTGGTCGACTCT
- 3′ sequencing primer CRUSH-rev GGGCCACAACTCCTCATAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Unique HpaI and XhoI sites were maintained for single step short hairpin oligonucleotide cloning.
Using the primers described above yields 429 bp and 374 bp for positive and negative products, respectively.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRUSH was a gift from Laurie Jackson-Grusby (Addgene plasmid # 54480 ; http://n2t.net/addgene:54480 ; RRID:Addgene_54480) -
For your References section:
RUSH and CRUSH: a rapid and conditional RNA interference method in mice. Brown JR, Zetsche B, Jackson-Grusby L. Genesis. 2014 Jan;52(1):39-48. doi: 10.1002/dvg.22718. Epub 2013 Oct 26. 10.1002/dvg.22718 PubMed 24166816
Map uploaded by the depositor.
