Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

P2-ECFP-pA (Construct 6)
(Plasmid #55198)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 55198 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL2-Luc (Addgene #26280)
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 4215
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCerulean
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    717
  • GenBank ID
    KJ796489
  • Promoter Minimal Ade MLP

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCC
  • 3′ sequencing primer AGTGCGGCGACGATAGTCATGCCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see http://www.rle.mit.edu/sbg/resources/ for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P2-ECFP-pA (Construct 6) was a gift from Timothy Lu (Addgene plasmid # 55198 ; http://n2t.net/addgene:55198 ; RRID:Addgene_55198)
  • For your References section:

    Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Nissim L, Perli SD, Fridkin A, Perez-Pinera P, Lu TK. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. 10.1016/j.molcel.2014.04.022 PubMed 24837679