iDuet101a-mCHF1
              
              
                (Plasmid
                
                #55611)
              
            
            
            
          - 
            PurposeLentivirus containing mouse Hey2 coding region
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 55611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneiDuet101a
- 
              Backbone manufacturerAddgene#17629
- Backbone size w/o insert (bp) 11426
- Total vector size (bp) 12624
- 
              Vector typeMammalian Expression, Lentiviral
- 
                Selectable markersHygromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)Stbl3
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameHey2
- 
                  Alt nameChf1
- 
                    SpeciesM. musculus (mouse)
- 
                  Insert Size (bp)1192
- 
                    GenBank IDNM_013904.1
- 
                        Entrez GeneHey2 (a.k.a. CHF1, Herp1, Hrt2, bHLHb32, hesr2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GTTTGGATCTTGGTTCATTC
- 3′ sequencing primer TCGTTAACCTCGAGTGTAC (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byVector iDuet101a was purchased from Addgene #17629
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: iDuet101a-mCHF1 was a gift from Michael Chin (Addgene plasmid # 55611 ; http://n2t.net/addgene:55611 ; RRID:Addgene_55611)
- 
                For your References section: An optimized and simplified system of mouse embryonic stem cell cardiac differentiation for the assessment of differentiation modifiers. Hartman ME, Librande JR, Medvedev IO, Ahmad RN, Moussavi-Harami F, Gupta PP, Chien WM, Chin MT. PLoS One. 2014 Mar 25;9(3):e93033. doi: 10.1371/journal.pone.0093033. eCollection 2014. 10.1371/journal.pone.0093033 PubMed 24667642
 
    
 
                         
             
            