pcDNA SF-HERC2 F5
(Plasmid
#55788)
-
PurposeExpresses N-terminal 3xFLAG/STREP tagged HERC2 (3550-4450aa)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 55788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1+
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 8325
-
Modifications to backboneThe following sequence encoding 3xFLAG/STREP tag was cloned into the NheI/BamHI sites of pcDNA3.1(+): GCTAGCACGCGTCCACCATG gactacaaagaccatgacggtgattataaagatcatgacatcgattacaaggatgacgatgacaag GGGTCGGCCTGGAGCCACCCGCAGTTCGAAAAA GGATCC
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFLAG tagged HERC2 (3550-4450aa)
-
Alt nameHERC2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2825
-
GenBank IDNM_004667.5
-
Entrez GeneHERC2 (a.k.a. D15F37S1, MRT38, SHEP1, jdf2, p528)
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- STREP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer CGC AAA TGG GCG GTA GGC GTG
- 3′ sequencing primer TAG AAG GCA CAG TCG AGG C (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA SF-HERC2 F5 was a gift from David Chan (Addgene plasmid # 55788 ; http://n2t.net/addgene:55788 ; RRID:Addgene_55788) -
For your References section:
Degradation of the Deubiquitinating Enzyme USP33 is Mediated by p97 and the Ubiquitin Ligase HERC2. Chan NC, den Besten W, Sweredoski MJ, Hess S, Deshaies RJ, Chan DC. J Biol Chem. 2014 May 22. pii: jbc.M114.569392. 10.1074/jbc.M114.569392 PubMed 24855649