pcDNA3-WT-VLCAD-FLAG
(Plasmid
#55823)
-
PurposeExpresses WT-VLCAD in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 55823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 7500
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVery long-chain specific acyl-CoA dehydrogenase
-
Alt nameVLCAD
-
Alt nameACADVL
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2000
-
Entrez GeneACADVL (a.k.a. ACAD6, LCACD, VLCAD)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GAATTCATGCAGGCGGCTCGGATGGC
- 3′ sequencing primer GCGGCCGCTCTGAAGCCAAGTGGGTTGCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-WT-VLCAD-FLAG was a gift from Yoshimi Homma (Addgene plasmid # 55823 ; http://n2t.net/addgene:55823 ; RRID:Addgene_55823) -
For your References section:
Dysregulation of very long chain acyl-CoA dehydrogenase coupled with lipid peroxidation. Kabuyama Y, Suzuki T, Nakazawa N, Yamaki J, Homma MK, Homma Y. Am J Physiol Cell Physiol. 2010 Jan;298(1):C107-13. doi: 10.1152/ajpcell.00231.2009. Epub 2009 Nov 4. 10.1152/ajpcell.00231.2009 PubMed 19889959