Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMXsIP GFP-VPS33A
(Plasmid #67022)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67022 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMXs-IP
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 5847
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Vacuolar protein sorting 33 homolog A (S. cerevisiae) (VPS33A)
  • Species
    H. sapiens (human)
  • Entrez Gene
    VPS33A (a.k.a. MPSPS)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The P21R mutation in VPS33A has no functional consequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXsIP GFP-VPS33A was a gift from Noboru Mizushima (Addgene plasmid # 67022 ; http://n2t.net/addgene:67022 ; RRID:Addgene_67022)
  • For your References section:

    The HOPS complex mediates autophagosome-lysosome fusion through interaction with syntaxin 17. Jiang P, Nishimura T, Sakamaki Y, Itakura E, Hatta T, Natsume T, Mizushima N. Mol Biol Cell. 2014 Apr;25(8):1327-37. doi: 10.1091/mbc.E13-08-0447. Epub 2014 Feb 19. 10.1091/mbc.E13-08-0447 PubMed 24554770