-
PurposeHuman VPS16 ORF was inserted into pMRXIP GFP-N vector
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMRXIP GFP-N
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 9120
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHomo sapiens vacuolar protein sorting 16 homolog (S. cerevisiae) (VPS16)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2520
-
Entrez GeneVPS16 (a.k.a. DYT30, hVPS16)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtggaccatcctctagact
- 3′ sequencing primer AAAAGACGGCAATATGGTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRXIP VPS16-GFP was a gift from Noboru Mizushima (Addgene plasmid # 67023 ; http://n2t.net/addgene:67023 ; RRID:Addgene_67023) -
For your References section:
The HOPS complex mediates autophagosome-lysosome fusion through interaction with syntaxin 17. Jiang P, Nishimura T, Sakamaki Y, Itakura E, Hatta T, Natsume T, Mizushima N. Mol Biol Cell. 2014 Apr;25(8):1327-37. doi: 10.1091/mbc.E13-08-0447. Epub 2014 Feb 19. 10.1091/mbc.E13-08-0447 PubMed 24554770