pFGL820
(Plasmid
#58221)
-
PurposeFor fungal transformation via ATMT. Transformants to be selected by sulfonylurea (specially chlorimuro ethyl) resistance.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58221 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFGL815
-
Modifications to backboneSulfonylurea resistance (SUR) cassette (2.8kb)has been cloned into pFGL815 (Addgene 52322) between Xba1 and Sal1 sites.
-
Vector typeBacterial Expression
-
Selectable markersSulfonylurea (chlorimuron ethyl)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameILV2
-
Alt nameSUR
-
SpeciesMagnaporthe grisea
-
Insert Size (bp)2830
-
GenBank IDAF013601
- Promoter ILV2 native promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CACCTCGAGGTGCCAACGCCACAGTGCCCCACATCT
- 3′ sequencing primer CGACGTCGACATGCAATTCCCGTGCAATAATCAATTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypCB1550 from FGSC (Fungal Genetics Stock Center).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Reference:
Sweigard J, Chumley F, Carroll A, Farrall L, Valent B (1997) A series of vectors for fungal transformation. Fungal Genet Newsl 44: 52-53
Please note that the actual sequence of the SUR gene in this plasmid differs from the Genbank reference sequence AF013601 by a G120V mutation in the ILV2 locus. G120V does not contribute to the sulfonyl urea resistance per se.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFGL820 was a gift from Naweed Naqvi (Addgene plasmid # 58221 ; http://n2t.net/addgene:58221 ; RRID:Addgene_58221) -
For your References section:
A series of vectors for fungal transformation. Sweigard JA, Chumley F, Carroll A, Farrall L, Valent B. Fungal Genetics Reports, 1997. Vol. 44, Article 19 10.4148/1941-4765.1287