-
Depositing Lab
-
Depositing OrganizationColorado State University, Fort Collins
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMRBAD
- Backbone size w/o insert (bp) 4496
- Total vector size (bp) 4867
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLeucine Zipper prime - C super positive Green Fluorescent Protein
-
Alt nameZ'-CspGFP
-
SpeciesSynthetic
-
Insert Size (bp)371
- Promoter pBad
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer GCACGGCGTCACACTTTGC
- 3′ sequencing primer GCAAAAAACCCCTCAAGACCCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRBad-Z-CspGFP was a gift from Brian McNaughton (Addgene plasmid # 40730 ; http://n2t.net/addgene:40730 ; RRID:Addgene_40730) -
For your References section:
Split-superpositive GFP reassembly is a fast, efficient, and robust method for detecting protein-protein interactions in vivo. Blakeley BD, Chapman AM, McNaughton BR. Mol Biosyst. 2012 Aug;8(8):2036-40. Epub 2012 Jun 12. 10.1039/c2mb25130b PubMed 22692102