This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #40730)


Item Catalog # Description Quantity Price (USD)
Plasmid 40730 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4496
  • Total vector size (bp) 4867
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Leucine Zipper prime - C super positive Green Fluorescent Protein
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter pBad

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer GCACGGCGTCACACTTTGC
  • 3′ sequencing primer GCAAAAAACCCCTCAAGACCCG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRBad-Z-CspGFP was a gift from Brian McNaughton (Addgene plasmid # 40730 ; ; RRID:Addgene_40730)
  • For your References section:

    Split-superpositive GFP reassembly is a fast, efficient, and robust method for detecting protein-protein interactions in vivo. Blakeley BD, Chapman AM, McNaughton BR. Mol Biosyst. 2012 Aug;8(8):2036-40. Epub 2012 Jun 12. 10.1039/c2mb25130b PubMed 22692102