Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUWR-CadTS
(Plasmid #58325)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58325 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUWR
  • Backbone manufacturer
    Clara Moch at Jean-Rene Huynh's Laboratory
  • Backbone size w/o insert (bp) 12396
  • Total vector size (bp) 18498
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    E-cadherin tension sensor
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    6102
  • GenBank ID
    KJ826435
  • Promoter poly-ubiquitin

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCAGCCAGGAAGTTAGTT
  • 3′ sequencing primer GGACAGCTTCAAGTAGTCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUWR-CadTS was a gift from Denise Montell (Addgene plasmid # 58325 ; http://n2t.net/addgene:58325 ; RRID:Addgene_58325)
  • For your References section:

    Mechanical Feedback through E-Cadherin Promotes Direction Sensing during Collective Cell Migration. Cai D, Chen SC, Prasad M, He L, Wang X, Choesmel-Cadamuro V, Sawyer JK, Danuser G, Montell DJ. Cell. 2014 May 22;157(5):1146-59. doi: 10.1016/j.cell.2014.03.045. 10.1016/j.cell.2014.03.045 PubMed 24855950