-
Purpose(Empty Backbone) UAS vector to express gene of interest in Drosophila
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58372 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUAST-attB
-
Modifications to backboneA 500 pb DNA fragment containing 10X UAS and hsp70 core promoter was obtained from pMF3 (Dietzl et al., 2007) by restriction digestion and used to replace the 5X UAS-hsp70 fragment in pUAST-attB (Bischof et al., 2007).
-
Vector typeInsect Expression
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer tgcaactactgaaatctgcc
- 3′ sequencing primer gtttgtccaattatgtcacacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUA was a gift from Chun Han & Yuh-Nung Jan (Addgene plasmid # 58372 ; http://n2t.net/addgene:58372 ; RRID:Addgene_58372) -
For your References section:
Epidermal cells are the primary phagocytes in the fragmentation and clearance of degenerating dendrites in Drosophila. Han C, Song Y, Xiao H, Wang D, Franc NC, Jan LY, Jan YN. Neuron. 2014 Feb 5;81(3):544-60. doi: 10.1016/j.neuron.2013.11.021. Epub 2014 Jan 9. 10.1016/j.neuron.2013.11.021 PubMed 24412417